Search results for: 'the dbms_pipe.receive_message chm 98 chr 98 chm 98 15'
- Did you mean
- the dbms_pipe.receive_message chm 98 chm 98 chm 98 15
- tbe dbms_pipe.receive_message chm 98 chr 98 chm 98 15
- Related search terms
- the clon chm đề bổ singl usdcvn.com xip
- the+clon+chm+đề+bổ+singl+usdcvn.com+xip
- Thể thao trực tuyến-【copy url:hk589.cn】-game rambo 2 nguoi choib50bb50b--【copy url:hk589.cn】-Xổ số Việt Nam No.1,tải game vui nh
- Thể thao trực tuyến-【copy url:hk588.top】-xo so thu 5 hang tuanjlxzjlxz--【copy url:hk588.top】-Xổ số Việt Nam No.1,thabet netcu5jy
- Thể thao trực tuyến-【copy url:hk589.net】-xo so thu 5 hang tuanhxphhxph--【copy url:hk589.net】-Xổ số Việt Nam No.1 Tỉ lệ cực cao 1
-
similar to DNA segment, Chr 18, Wayne State University 98, expressed (predicted) target clone (RGD1560212)0,00 €Rat similar to DNA segment, Chr 18, Wayne State University 98, expressed (predicted) target clone (Accession: NM_001077676. Symbols: RGD1560212 MGC156819) - RmiT048719 Learn More
-
nucleoporin 98 target clone (Nup98)0,00 €Mouse nucleoporin 98 target clone (Accession: NM_022979. Symbols: Nup98 4732457F17 AI849286 MGC118567) - MmiT032867 Learn More
-
hsmq-0594 against hsa-miR-980,00 €hsmq-0594 against hsa-miR-98 - MIMAT0000096 - 22b - UGAGGUAGUAAGUUGUAUUGUU Learn More
-
transmembrane protein 98 target clone (TMEM98)0,00 €Human transmembrane protein 98 target clone (Accession: NM_001033504. Symbols: TMEM98 DKFZP564K1964) - HmiT006972 Learn More
-
transmembrane protein 98 target clone (Tmem98)0,00 €Rat transmembrane protein 98 target clone (Accession: NM_001007672. Symbols: Tmem98 MGC93733) - RmiT045350 Learn More
-
olfactory receptor 98 target clone (Olfr98)0,00 €Mouse olfactory receptor 98 target clone (Accession: NM_146510. Symbols: Olfr98 MOR156-4) - MmiT039150 Learn More
-
transmembrane protein 98 target clone (Tmem98)0,00 €Mouse transmembrane protein 98 target clone (Accession: NM_029537. Symbols: Tmem98 6530411B15Rik AI463522) - MmiT036141 Learn More
-
olfactory receptor 98 (predicted) target clone (Olr98)0,00 €Rat olfactory receptor 98 (predicted) target clone (Accession: NM_001000143. Symbols: Olr98 Olr98) - RmiT043842 Learn More
-
coiled-coil domain containing 98 target clone (CCDC98)0,00 €Human coiled-coil domain containing 98 target clone (Accession: NM_139076. Symbols: CCDC98 FLJ11520 FLJ12642 FLJ13614) - HmiT020507 Learn More
-
G protein-coupled receptor 98 target clone (Gpr98)0,00 €Mouse G protein-coupled receptor 98 target clone (Accession: NM_054053. Symbols: Gpr98 Frings Mass1 Mgr1 VLGR1) - MmiT037080 Learn More