miRNA RT-qPCR Detection
-
All-in-One™ miRNA qRT-PCR Detection Kit and validated miRNA primers0,00 €miRNA PCR analysis detection and profiling through RT-qPCR system validated miRNA primers Learn More -
All-in-One™ miRNA qRT-PCR Detection Kit* (20 RT and 200 qPCR reactions)495,00 €Poly A Polymerase, RTase Mix, qPCR Mix, ROX Reference Dye, Universal Adaptor PCR Primer and other buffers (for use with miRNA qPCR primers) Learn More -
All-in-One™ miRNA qRT-PCR Detection Kit* (60 RT and 600 qPCR reactions)1 135,00 €Poly A Polymerase, RTase Mix, qPCR Mix, ROX Reference Dye, Universal Adaptor PCR Primer and other buffers (for use with miRNA qPCR primers) Learn More -
All-in-One™ miRNA First-Strand cDNA Synthesis Kit (20 RT reactions)395,00 €Poly A Polymerase, RTase Mix, PAP/RT buffer, spike-in control (for use with miRNA qPCR arrays) Learn More -
All-in-One™ miRNA First-Strand cDNA Synthesis Kit (60 RT reactions)600,00 €Poly A Polymerase, RTase Mix, PAP/RT buffer, spike-in control (for use with miRNA qPCR arrays) Learn More -
All-in-One™ qPCR Mix (20 µl x 200 qPCR reactions)340,00 €High-fidlity, hot-start DNA polymerase, optimized reaction buffer and dNTPs Learn More -
All-in-One™ qPCR Mix (20 µl x 600 qPCR reactions)495,00 €High-fidlity, hot-start DNA polymerase, optimized reaction buffer and dNTPs Learn More -
All-in-One™ qPCR Mix (1000 qPCR reactions)795,00 €High-fidlity, hot-start DNA polymerase, optimized reaction buffer and dNTPs Learn More -
All-in-One™ qPCR Mix (4000 qPCR reactions)1 995,00 €High-fidlity, hot-start DNA polymerase, optimized reaction buffer and dNTPs Learn More -
hsmq-0020 against hsa-miR-12060,00 €hsmq-0020 against hsa-miR-1206 - MIMAT0005870 - 21b - UGUUCAUGUAGAUGUUUAAGC Learn More