Search results for: 'SKU CoV2Ag 25'
- Did you mean
- sku cov2 25
- sku col2a1 25
- Related search terms
- sku cov2ag 25 nvopzp and 1 1 or ikb
- sku cov2ag 25 nvopzp and 1 1 or ikk
- sku col2a1 25 nvopzp and 1 1 or ikb
- sku+cov2ag+25+nvopzp+and+1+1+or+ikk
- sku+col2a1+25+nvopzp+and+1+1+or+ikb
-
interleukin 25 target clone (Il25)0,00 €Mouse interleukin 25 target clone (Accession: NM_080729. Symbols: Il25 IL-17E Il17e) - MmiT037197 Learn More
-
keratin 25 target clone (Krt25)0,00 €Mouse keratin 25 target clone (Accession: NM_133730. Symbols: Krt25 4631426H08Rik Ka38 Krt25a mIRSa1) - MmiT037440 Learn More
-
PROTEIN KINASES; Recombinant Human Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1 (25-235) (LYVE-1 (25-235)), 1mg1 193,00 €PROTEIN KINASES, Recombinant Human Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1 (25-235) (LYVE-1 (25-235)), 1mg, PKA- 349C Learn More
-
hsmq-0089 against hsa-miR-250,00 €hsmq-0089 against hsa-miR-25 - MIMAT0000081 - 22b - CAUUGCACUUGUCUCGGUCUGA Learn More
-
PROTEIN KINASES; Recombinant Human Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1 (25-235) (LYVE-1 (25-235)), 2µg104,00 €PROTEIN KINASES, Recombinant Human Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1 (25-235) (LYVE-1 (25-235)), 2µg, PKA- 349A Learn More
-
PROTEIN KINASES; Recombinant Human Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1 (25-235) (LYVE-1 (25-235)), 10µg185,00 €PROTEIN KINASES, Recombinant Human Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1 (25-235) (LYVE-1 (25-235)), 10µg, PKA- 349B Learn More
-
Fatty Tissue RNA Purification Kit (25 prep)208,00 €Fatty Tissue RNA Purification Kit (25 prep) Learn More
-
Milk DNA Preservation and Isolation Kit (25)245,00 €Milk DNA Preservation and Isolation Kit (25) Learn More
-
defensin beta 25 target clone (Defb25)0,00 €Rat defensin beta 25 target clone (Accession: NM_001037516. Symbol: Defb25) - RmiT048228 Learn More
-
cholesterol 25-hydroxylase target clone (Ch25h)0,00 €Rat cholesterol 25-hydroxylase target clone (Accession: NM_001025415. Symbol: Ch25h) - RmiT047594 Learn More