Search results for: 'under armer clon magnet pro website：supeflyshoe.com 500'

RECOMBINANT & NATURAL PROTEINS, Recombinant Human Thioredoxin (TXN1 (Thioredoxin)), 500µg, PRO- 569B Learn More

RECOMBINANT & NATURAL PROTEINS, Recombinant Limulus Antilipopolysaccharide Factor (LALF), 500µg, PRO- 361C Learn More

RECOMBINANT & NATURAL PROTEINS, Recombinant Human C-Reactive Protein (CRP), 500µg, PRO- 335A Learn More

2X PCR Master Mix - 500 Reactions Learn More

Catalase Activity Assay Kit (500 tests) Learn More

hsmq-0398 against hsa-miR-500 - MIMAT0004773 - 23b - UAAUCCUUGCUACCUGGGUGAGA Learn More

Rattus norvegicus microRNA miR-500 stem-loop (accession: "MI0006153") expression clone - RmiR6232 Learn More

Homo sapiens microRNA miR-500 stem-loop (accession: "MI0003184") expression clone - HmiR0373 Learn More

Mus musculus microRNA miR-500 stem-loop (accession: "MI0004702") expression clone - MmiR3109 Learn More

XcyteTM and XcyteTM Plus media supplements have been developed for the express purpose of providing xeno-free materials for the growth, expansion, and culture of human cells; stem cells in particular. When used as directed XcyteTM medias provide the complex mixture of growth factors, hormones, attachment factors, electrolytes and lipids needed to sustain healthy cells. Learn More